Chop that DNA!

Chop that DNA!

Is human, mouse and horse DNA the same?

Have a look at Molecular scissors to find out more about restriction enzymes.

Below are the DNA sequences for part of the haemoglobin molecule in humans, mice and horses.

Haemoglobin is a protein found in red blood cells that helps to transport oxygen around the body.

Is haemoglobin the same in humans, mice and horses?

The haemoglobin protein produced by this DNA performs the same function in all three species. Do you think the number of restriction enzyme recognition sites will be the same for all three pieces of DNA?

Compare the different recognition sequences found in this piece of DNA.

To do this, you can use an online DNA cutter. The website will cut your DNA with all the common restriction enzymes known to scientists.

Cut and paste each sequence into the empty white box on the DNA cutter website. Then press submit.  Within a few seconds, the known restriction sites on that section of DNA should be shown.

For each species, count the number of times these three restriction enzymes appear in the list:

  • BamH1
  • Not 1
  • Pst 1

Are the numbers same or different for each species? Can you think of a reason why the numbers might be different?

The DNA sequence for each haemoglobin molecule is below:

Human

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAG ACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGG TGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGAC AACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACT TCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAG GAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCT CAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCT TTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATA TCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAAT ATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAAT CATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAA TTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATA CTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAG AATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAAT TGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTT ATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTT ATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

Mouse

TTACGTTTGCTTCTGATTCTGTTGTGTTGACTTGCAACCTCAGAAACAGACATCATGGTGCACCTGACTG ATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGGGGAAAGGTGAACGCCGATGAAGTTGGTGGTGAGGCCCT GGGCAGGTTGGTATCCAGGTTACAAGGCAGCTCACAAGTAGAAGTTGGGTGCTTGGAGACAGAGGTCTGC TTTCCAGCAGGCACTAACTTTGAGTGTCCCCTGTCTATGTTTCCCTTTTTAGGCTGCTGGTTGTCTACCC TTGGACCCAGCGGTACTTTGATAGCTTTGGAGACCTATCCTCTGCCTCTGCTATCATGGGTAATGCCAAA GTGAAGGCCCATGGCAAGAAAGTGATAACTGCCTTTAACGATGGCCTGAATCACTTGGACAGCCTCAAGG GCACCTTTGCCAGCCTCAGTGAGCTCCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGGTGAG TCTGATGGGCACCTCCTGGGTTTCCTTCCCCTGGCTATTCTGCTCAACCTTCCTATCAGAAGGAAAGGGG AAGCGATTCTAGGGAGCAGTCTCCATGACTGTGTGTGGAGTGTTGACAAGAGTTTGGATATTTTATTCTC TACTCAGAATCGCTGCTCCCCCTCACTCTGTTCTGTGTTGTCATTTCCTCTTTCTTTGGTAAGCTTTTAA TTTCCAGTTGCATTTTACTAAATTAATTAAGCTGGTTATTTACTTCCCATCCTGATATCAGCTTCCCCTC CTCCTTTCCTCCCAGTCCTTCTCTCTCTCCTCTCTCTTTCTCTAATCCTTTCCTTTCCCTCAGTTCATTT CTTCTTCTTTGATCTACTTTTGTTTGTCTTTTTAAATATTGCCTTGTAACTTACTCAGAGGACAAGGAAG ATATGTCCCTGTTTCTTCTCATAGCTCTCAAGAATAGTAGCATAATTGGCTTTTATGCCAGGGTGACAGG GGAAGAATATATTTTACATATAAATTCTGTTTGACATAGGATTCTTATAATAATTTGTCAGCAGTTTAAG GTTGCAAACAAATGTCTTTATAAATAAGCCTGCAGTATCTGGTATTTTTGCTCTACAGTTATGTTGATGG TTCTTCCATCTTCCCACAGCTCCTGGGCAATATGATCGTGATTGTGCTGGGCCACCACCTGGGCAAGGAT TTCACCCCCGCTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCTGCTGCCCTGGCTCACAAGT ACCACTAAGCCCCTTTTCTGCTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCAAT TGTGGGGAAATGATGAAGACCTTTGGGCATCTAGCTTTTATCTAATAAATGATATTTACTGTCATC

Horse

ATGGTGCAACTGAGTGGTGAAGAGAAGGCAGCTGTCTTGGCCCTGTGGGACAAGGTGAATGAGGAAGAAG TTGGTGGTGAAGCCCTGGGCAGGTTAGTATCCAGGATACAAGCAGCTTAAGGAGAGTCGTAGAAGCTGGG TATGTGAATATACGACCGTCTCCTGGGTTTCTGACAGGTACTGACTGCCTCTGTCTCTTGTGCTGTTTAA AACCTCTTAGGCTGCTGGTTGTCTACCCATGGACTCAGAGGTTCTTTGACTCCTTTGGGGATCTGTCCAA TCCTGGTGCTGTGATGGGCAACCCCAAGGTGAAGGCCCACGGCAAGAAAGTGCTACACTCCTTTGGTGAG GGCGTGCATCATCTTGACAACCTCAAGGGCACCTTTGCTGCGCTGAGTGAGCTGCACTGTGACAAGCTGC ACGTGGATCCTGAGAACTTCAGGGTGAGTCTCTGTGACCCTCAATTTCTCCTTTGCCTTCCTCTTTTTGG TCAAGCTCATGTAATGAGGAGAGGACATGAAAGTCAGGCTGCAGTTCAGAATGTGAAGAGATGTTGTGGT TGCATCACTGCGGACTCCGGAGGAACATTTAAGTTCTTTTATTTTCTTTGCTCAAAACCCTTGTTTCTGC TGGTTCATTCTTGTTTTCCTCTTTTTGGTCTCTGCAATATCTTCTCATTGTATTTTTAATTAAATTTTTT GAGTGTTTAATTAAAAACAACTTTCTTCTTTGAATCTACTTTCTTTTTAAAAAAAAAATTCATCTAATAC TTTCTTTCCCTTGTCTCTAACTCTTTCTTTCAAAGCAAAAAGGATAACATGTATTATTGCTTCCTTTCAT GGTTCTAAAGAATAACATAACAAGTTCTGGGTTAAGGCAGAAAGGGAGAGACATTTTTAAGTATAAATTC AGGTTGTTATTAGCGGATTCACATAAATAGTAACATCCAAGATTCAGCTATTTTCCTGCTTATATTCTAG GGCACAGCTTTGGATAAGATTGGAATATTCTGAGCCCAAGCTGCTTCCCTCTGCTAACCATGCCCCCTCT TTTTTCTCTTCCCCACAGCTCCTGGGCAACGTGCTGGTTGTTGTGCTGGCTCGCCACTTTGGCAAGGATT TCACCCCAGAGTTGCAGGCTTCCTATCAAAAGGTGGTGGCTGGTGTGGCCAATGCACTGGCCCACAAATA CCACTGA

By Zara Mahmoud, ScienceBuz

Sign up for the newsletter
Sign Up For The Newsletter
Want to get the latest science news from Planet Science straight to your inbox? Sign up now!